Chim Việt Cành Nam            [  Trở Về  ]          [ Trang chủ ]            


 

AUSTROASIATIC

Đỗ Ngọc Giao

 

phần 2 theo nhân chủng học (molecular anthropology), ta biết sắc dân Việt Nam (viết tắt“VN”), nói riêng đàn ông, gồm hơn mười đám người khác nhau, thuộc về những Y-DNA haplogroup khác nhau, trong đó cái đámđông nhứt thuộc về haplogroup O2a1a (biểu 1a-b).

 

Biểu 1a: vẽlại theo Tatiana Karafet et al [1]

Biểu 1b: vẽ lại theo Jun-Dong He et al [2]

Như vậy, t́m hiểu nguồn gốc người VN là t́m hiểu nguồn gốc của hơn mười đám người: họ từ đâu tới, nói thứ tiếng ǵ, theo tục lệ ǵ, đám nào tới trước, đám nào tới sau,... Nhưng đó chưa phải hết thảy câu chuyện, mà mới là một nửa. Trong nửa kia của câu chuyện, đàn bà VN cũng gồm vài đám người khác nhau thuộc về những mtDNA haplogroup khác nhau; và ta cũng phải t́m hiểu nguồn gốc của những đám đàn bà đó, dù chưa ai dám khoe là hiểu rơ đàn bà. Tóm lại, kể chuyện nguồn gốc người VN là một việc khó dàn trời, chớ chẳng phải dễ ăn.

Ở phần này, trước hết, ta dợt tiếp bài học vỡ ḷng đă tạm ngưng ở phần 2.

Deoxyribonucleic acid (viết tắt “DNA”), nói sơ sài, là một dăy những nucleotide nối tiếp nhau, mỗi nucleotide mang một cái base hoặc là adenine (viết tắt “A”), hoặc là guanine (viết tắt “G”), hoặc là cytosine (viết tắt “C”), hoặc là thymine (viết tắt“T”). Thứ tự của những nuceotide trên dăy, theo một hướng nào đó làm chuẩn, chính là cái information hướng dẫn cách gầy dựng và giữ ǵn một cơ thể. DNA thường gồm hai dăy giống như hai cạnh của một cái thang mà mỗi bậc thang là một cặp base (base pair, viết tắt “bp”) gắn với nhau: A gắn với T, C gắn với G; thí dụ dăy này có chuỗi AATTGACAT th́ dăy kia sẽ có chuỗi ATGTCAATT theo hướng ngược lại (h́nh 1).

 

H́nh 1

DNA được “gói” thành những chromosome (nhiễm sắc thể) trong mỗi nhân tế bào; con người có 23 cặp chromosome với hơn 3 tỉ bp, riêng cái Y chromosome trong cặp số23 mà ông Trời dành riêng cho đàn ông th́ có hơn 57 triệu bp. (C̣n một thứ DNA nữa trong mỗi cái mitochondrion trong từng tế bào, viết tắt “mt-DNA”, th́ không nói ở đây.)

Thí dụ vợ chồng bạn đẻ một đứa con trai, bạn để lại cho nó một sợi chromosome và vợ bạn để lại cho nó một sợi chromosome. Riêng cái sợi chromosome của bạn để lại cho nó chính là sợi của cha bạn hoặc là sợi của mẹ bạn để lại, nhưng không phải 100% trường hợp đều là nguyên xi, mà trong 25% trường hợp th́ sợi của cha bạn sẽ bị pha một mẩu của mẹ bạn và trong 25% trường hợp th́ sợi của mẹ bạn sẽ bị pha một mẩu của cha bạn (h́nh 2).

Tới khi con trai bạn để lại cho cháu bạn cái sợi-đă-bị-pha nói trên th́ sợi đó lại bị pha thêm một mẩu của vợ bạn trong 25% trường hợp.

Như vậy, DNA của bạn khi truyền lại con bạn th́ đă mất một chút, từ con bạn truyền lại cháu bạn th́ mất thêm một chút nữa, cho tới đứa cháu đời thứ một trăm của bạn (hơn 2 ngàn năm sau) th́ có thể nó không c̣n mang một miếng DNA nào của bạn truyền lại nữa, dù vậy nó vẫn là “ đích tôn”của bạn.

 

H́nh 2

Riêng cái sợi Y chromosome chung cặp số 23 với sợi X chromosome th́ khác hẳn: sợi Y chỉcó thể pha với sợi X ở hai đầu, c̣n khúc giữa chiếm 95% bề dài sợi Y, gọi là male specific region, th́ không bao giờ pha mà cứ thế truyền từ đời này sang đời khác:

… ® ông cố nội ® ông nội ® cha ® con trai ® cháu trai ® …

và tới đời thằng cháu đời thứ một trăm của bạn, nó vẫn giữ nguyên xi Y-DNA của bạn.

Song le, thỉnh thoảng, vào một đời nào đó, lại xảy ra một cái mutation (khác biệt đột ngột) cho DNA trên bất kỳ chromosome nào, theo vài cách chẳng hạn như sau:

  • ở một vị trí nào đó trên DNA, một base bị thay bằng một cái base khác, thí dụ base T bị thay bằng base C (h́nh 3), cái này kêu bằng single nucleotide polymorphism(viết tắt “SNP”).

 

H́nh 3

  • ở một vị trí nào đó trên DNA, một chuỗi nucleotide được thêm vô (insertion) hoặc xóađi (deletion), cái này gọi chung là indel, thí dụ cái “Alu insertion” trên Y chromosome gồm 1124 bp xảy ra lối 65 ngàn năm trước mà chừng 3% đực rựa người VN ngày nay thuộc về Y-haplogroup D đang mang trong ḿnh (biểu 1a).

Mỗi cái mutation nói trên ít khi nào xảy ra 2 lần ở 2 người khác nhau, nên được gọi là “unique event polymorphism”.

Mutation nếu xảy ra trong một vùng đặc biệt của DNA gọi là “gene” th́ nó có thể gây hại cho người và như vậy không truyền được qua nhiều đời; nhưng nếu nó xảy ra bên ngoài gene th́ nó chẳng làm chết thằng tây nào và cứ thế truyền măi tới ngày nay.

Nếu bạn mang một cái mutation trên một chromosome nào đó không phải Y chromosome, th́ như đă nói trên, tới đứa cháu đời thứ một trăm của bạn, có lẽ cái mutation đó sẽ mất tiêu.

Nhưng nếu bạn mang một cái mutation trên Y chromosome, th́ như đă nói trên, tới đứa cháu trai đời thứ một trăm của bạn, cái mutation đó vẫn c̣n nguyên; và nếu lúc đó đàn cháu mang cái mutation đó đă đông người (ít nhứt 1% dân số đực rựa trên trái đất) th́ cái mutation đó trở thành một “dấu hiệu” (marker) chắc chắn để phân biệt nhóm đực rựa nào mang nó với một nhóm đực rựa khác không mang nó, mỗi nhóm gọi là một Y-DNA haplogroup (viết tắt “hg”) có chung ông tổ là người đầu tiên mang cái marker đó.

Xem thêm h́nh 4.

 

H́nh 4

Thí dụ ta bắt đầu từ hg Z với marker SNP 0, theo ḍng thời gian sẽ có:

  • Z1 là một “nhánh” (subclade) của hg Z, với SNP 0 và marker mới là SNP 1,
  • Z2 là một nhánh khác của hg Z, với SNP 0 và marker mới là SNP 2,
  • Z1a là một nhánh của hg Z1, với SNP 0, SNP 1 và marker mới là SNP 3,
  • Z2a là một nhánh của hg Z2, với SNP 0, SNP 2 và marker mới là SNP 4.

Nếu dưới Z1a và Z2a không có thêm nhánh mới nào khác, 5 đám đó đều có đực rựa nối dơi, và tất cả vẫn sống chung tới bây giờ thành một nhóm, th́ nhóm đó bao gồm 5đám đực rựa thuộc về 5 hg: Z1a, Z1*, Z2a, Z2* và Z*, có chung ông tổ là người đầu tiên mang cái marker SNP 0 (h́nh 5).

 

H́nh 5

Ta có:

Z = Z1 + Z2 + Z*

Z1 = Z1a + Z1*

Z2 = Z2a + Z2*

Z(xZ1) = Z2 + Z* = mọi nhánh của Z mà không phải Z1

Thường th́ 5 đám đó không ở lại cùng nơi mà chia nhau đi bốn phương trời rồi sống chung với những đám khác nữa, cuối cùng thành ra những sắc dân khác nhau.

Bởi vậy, sắc dân nào bây giờ cũng là một mớ hổ lốn những đám đực rựa thuộc về những hg khác nhau, dù bề ngoài có vẻ như là một đám, nói cùng thứ tiếng, theo cùng văn hóa. Thí dụ như sắc dân VN mà ta đă nêu (biểu 1a-b). Một thí dụ nữa, mấy anh chàng ở h́nh 6 dưới đây đều là người của sắc dân Hán, nhưng có thể thuộc về những hg khác nhau.

 

H́nh 6

Cho nên, nói sắc dân này hoặc không phải là sắc dân kia, th́ không có nghĩa ǵ hết.

Hiểu ra điều đó, trên con đường đi t́m nguồn gốc, ta sẽ chẳng bị lạc vô những chỗ mù sương, tức là chẳng phải nghĩ đến những điều không có nghĩa, thí dụ như:

1. người VN (gồm hơn 10 đám) là người Lạc Việt xưa (chưa biết gồm bao nhiêu đám)

2. người Lawa (gồm nhiều đám) là người Lạc Việt xưa (chưa biết gồm bao nhiêu đám)

3. người Hẹ (gồm nhiều đám) là người Lạc Việt xưa (chưa biết gồm bao nhiêu đám)

H́nh 7 vẽ một cây hg (Y-DNA haplogroup tree) [3] từ đó lần lượt mọc ra những hg như là những cái cành, tượng trưng cho những đám đực rựa khác nhau trên trái đất ngày nay mà đều là cháu chắt của một ông tổ sống ở châu Phi chừng 142,000 năm trước gọi là Y-Adam (hg màu hồng là ở lại châu Phi, hg màu xanh là đi khỏi châu Phi).

 

dngiao/3.7.png

H́nh 7

Ta tạm ngưng bài học vỡ ḷng ở đây, và bắt đầu t́m hiểu những hg trong sắc dân VN.

***

H́nh 8 cho thấy O2a1a-M88 (đám đực rựa đông nhứt của người VN) là nhánh của O2a1-M95 ở nhánh O2 trên cành O.

 

H́nh 8

Vậy muốn t́m hiểu gốc gác của O2a1a-M88, ta cần t́m hiểu O2a1-M95 trước, dù ǵ chừng 10% đàn ông VN cũng thuộc về O2a1-M95.

M95 là một cái SNP mà base C bị đổi thành T:

…GATAAGGAAAGACTACCATATTAGTG[C/T]TGGATGGCTTAGCCTTTCCAACCTG...

vịtrí 20,397,832 trên Y chromosome (h́nh 9).

H́nh 9

(Những cái SNP và indel có kư hiệu “M” là do nhóm nghiên cứu của Peter Underhill, Ph.D. ở Stanford University, t́m ra.)

Mang M95 không phải mặc nhiên là người VN, v́ đàn ông những sắc dân khác cũng có người mang M95.

Mang M95 cũng không làm cho đàn ông có da sậm hơn hay tóc xoăn hơn, v́ M95 không xảy ra trong vùng gene.

Nào ta xem O2a1-M95* đang “đầu quân” cho những sắc dân nào.

Biểu 2. Phần trăm đực rựa thuộc O2a1-M95* trong 22 nhóm nói những thứ tiếng Hmong-Mien ở nam TQ, vẽ lại theo Xiaoyun Cai et al [4].

 

 

Biểu 3. Phần trăm đực rựa thuộc O2a1-M95* trong 24 nhóm nói những thứ tiếng Mon-Khmer ở Đông nam Á, vẽ lại theo Xiaoyun Cai et al [op. cit.].

 

 

Biểu 4: phần trăm đực rựa thuộc O2a1-M95* trong 15 nhóm Hán và 16 nhóm nói những thứ tiếng Tibeto-Burman ở TQ, vẽ lại theo Bing Su et al [5].

 

 

Biểu 5: phần trăm đực rựa thuộc O2a1-M95* trong 31 nhóm ở Vân Nam (TQ), vẽ lại theo Zhili Yang et al [6].

 

 

Biểu 6: phần trăm đực rựa thuộc O2a1-M95* trong 27 nhóm ở Đông Á, vẽ lại theo Yali Xue et al [7].

 

 

Biểu 7: phần trăm đực rựa thuộc O2a1-M95* trong 18 nhóm ở TQ, vẽ lại theo Li Hui et al [8].

 

 

Biểu 8: phần trăm đực rựa thuộc O2a1-M95* trong 9 nhóm đông bắc châu Á và 21 nhóm đông nam châu Á , vẽ lại theo Bing Su et al [9].

 

 

Biểu 9: phần trăm đực rựa thuộc O2a1-M95* trong 13 nhóm Indonesia và 10 nhóm Oceania, vẽ lại theo Tatiana Karafet et al [1].

 

dngiao/3.f9.png?height=400&width=278

 

Biểu 10: phần trăm đực rựa thuộc O2a1-M95* trong 24 nhóm ở đông bắc Ấn Độ, vẽ lại theo Vikrant Kumar et al [10].

 

dngiao/3.f10.png?height=400&width=317

 

Biểu 11: phần trăm đực rựa thuộc O2a1-M95* trong 24 nhóm ở đông bắc Ấn Độ, vẽ lại theo Gyaneshwer Chaubey et al [11].

 

dngiao/3.f11.png?height=400&width=349

 

Biểu 12: phần trăm đực rựa thuộc O2a1-M95* trong 11 nhóm Đông bắc Á và Đông nam Á, vẽ lại theo Han Jun-Jin et al [12].

 

dngiao/_/rsrc/1359213075619/friends/giao/origin/03/3.f12.png?height=240&width=400

Rất tiếc không có dữ liệu của những nhóm thiểu số bên VN, trừ hai nhóm Mường (biểu 3) và Chàm (xem lại bảng 5 phần 2). Nhưng vài nhóm bên VN có lẽ cũng chính là những nhóm bên Lào mà đă được khảo sát ở biểu 3, thí dụ:

Số liệu từ biểu 2 tới biểu 12, lọc bớt đôi chỗ khác biệt, cho thấy địa bàn của đám O2a1-M95* đại khái như sau:

  • rất đông trong những nhóm ở Lào và đông bắc Ấn Độ,
  • khá đông trong những nhóm ở nam TQ và đất liền Đông nam Á,
  • rất thưa trong những nhóm Hán và những nhóm khác ở Đông bắc Á,
  • gần như không có mặt ở những vùng đảo như Taiwan, Philippines và Ocenia.

Như vậy, cái gốc của O2a1-M95 có lẽ một là Lào hai là đông bắc Ấn Độ rồi từ đó lan ra những nơi khác. Vikrant Kumar et al [op. cit.] cho rằng cách nay chừng 65 ngàn năm đám O2a1-M95 đă ra đời trong những nhóm người là tổ tiên của những nhóm nói tiếng Munda ngày nay ở đông bắc Ấn Độ,rồi theo những nhóm đó sang Đông nam Á.

Given this and the fact that this haplogroup is nearly absent in other parts of India as well as in Western and Central Asia, one may safely conclude that O-M95 has originated in Mundari populations roughly around 65,000 YBP (95% C.I. 25,442 – 132,230), as suggested by TMRCA... The foregoing analysis therefore suggests in-situ origin of O-M95 haplogroup, most probably in the ancestors of present day Mundari populations, who might have carried it further to Southeast Asia.

(Nói đám O2a1-M95 ra đời cách nay chừng 65 ngàn năm th́ coi bộ hơi quá, v́ đám K-M9, ông tổ của O2a1-M95, cũng mới ra đời từ 40 tới 50 ngàn năm nay thôi.)

Ngược lại, Gyaneshwer Chaubey et al [op. cit.] cho rằng O2a1-M95 ra đời ở Đông nam Á chừng 20 ngàn năm trước, về sau mới di cư quaẤn Độ.

...The presence of a significant (approximately one-quarter) southeast Asian genetic component among Indian Munda speakers is consistent with this model, implying their recent dispersal from southeast Asia followed by extensive admixture with local Indian populations. The strongest signal of southeast Asian genetic ancestry among Indian Austroasiatic speakers is maintained in their Y chromosomes, with approximately two-thirds falling into haplogroup O2a. Geographic patterns of genetic diversity of this haplogroup are consistent with its origin in southeast Asia approximately 20 KYA, followed by more recent dispersal(s) to India.

...Overall, due to the apparent lack of geographic clustering of Indian Austroasiatic O2a Y-STR haplotypes in the phylogenetic network, our 15.9± 1.6 KYA age estimate for the Indian subset should not be taken as a genetic estimate of dispersal time of Austroasiatic groups to India, but rather, this date estimate can be considered as the upper boundary for any dispersal event(s) to India that involved the O2a lineage.

O2a1-M95* ở Lào và đông bắc Ấn Độ đều nói những thứ tiếng Austroasiatic (viết tắt “AA”). Như vậy, “nói tiếng AA” và “thuộc về hg O2a1-M95*” ắt là hai chuyện có liên quan với nhau chớ không phải ngẫu nhiên, tức là, đám O2a1-M95* vốn nói tiếng AA. Bây giờ ta xem mấy nhà ngôn-ngữ-học cho nguồn gốc của tiếng AA ở đâu (người VN cũng đang nói một thứtiếng AA).

Stanley Starosta [13] cho rằng tiếng AA ra đời bên trên ḍng Dương Tử (h́nh 10), về sau nhóm nói tiếng AA bị nhóm nói tiếng Hmong-Mien lấn qua phía tây lên cao nguyên Vân Nam, sau đó vài đám AA xuôi ḍng Mekong và mấy sông khác đi xuống Lào, vài đám AA đi tiếp qua Miến Điện và Ấn Độ... Nhữngđám ở lại trở thành tổ tiên những người nói tiếng Mon-Khmer, trong đó có mộtđám xuôi ḍng Mekong đi xuống vùng VN-Miên-Lào rồi lại tách ra 5 đám ở lại Miên và VN...

At about the same time the Huang He languages were forming, the language chain along the Yangzi River, which I will refer to as Proto-Yangzian, took rice rather than millet as its agricultural staple. It differentiated into the ancestors of the upriver AA and downriver HM languages.

…Subsequent to the HM expansion and possibly as a partial result of it, the AA language, the other first-order branch of Yangzian, moved west up the Yangzi River toward the Yunnan Plateau, bringing rice agriculture to this area. Here it initially prospered and spread southward along the Mekong and other rivers southeast and south, occupying most of Laos. Other groups crossed several major watersheds into northern Burma and Assam via the ‘Khasi Corridor’…

...From Assam, the pre-Mundas followed the Brahmaputra River into the northeast Indian plain, leaving behind the Khasis in Assam and acquiring many of the characteristic South Asian phonological and grammatical features from the previous Dravidian residents. All the remaining AA speakers other than the Munda are the ancestors of the modern MK languages.

A southeastern MK group, Pre-Proto-eastern MK, moved further down the Mekong River to the Vietnam-Cambodia-Laos border area and split into five subgroups to occupy Cambodia and Vietnam…

 

http://www.africanwater.org/images/yangtze_map.gif

H́nh 10

George van Driem [14] cho rằng cái gốc của tiếng AA là lưu vực sông Brahmaputraở đông bắc Ấn Độ (h́nh 10, góc dưới bên trái).

…Assuming the veracity of the father tongue hypothesis for the spread of Austroasiatic, the available data could be interpreted as pointing towards the Brahmaputra basin as the point of origin for this language family.

Ilia Peiros [15] th́ cho rằng tiếng AA xưa và tiếng Sino-Tibetan xưa có mượn qua mượn lại, mà ổng đă đoán cái gốc của Sino-Tibetan là đâu đó gần Himalaya, nên nếu ổng đoán trúng th́ cái gốc của AA cũng phải kếbên, không xa khúc giữa sông Dương Tử, có lẽ là miền núi kế đó ở Tứ Xuyên bây giờ (h́nh 11).

There is a significant number of words that are similar between Proto-AA and Proto-Sino-Tibetan, which I plan to discuss in a separate publication. Some of them can also be found in Schuessler’s etymological dictionary of Chinese [2007] and in [Peiros 1998: 226–27]. Their preliminary analysis suggests that the protolanguages were in contact, with borrowings travelling in both directions. Important cultural terms, such as the words for rice, were, however, excluded from this process. If my suggestion that the Sino-Tibetan homeland was located somewhere in the Sub-Himalayas [Peiros 1998] is correct, the AA homeland must have been nearby.

As may be seen, the discussed evidence altogether supports the proposal that the AA homeland was located somewhere not far from the mid-Yangtze valley, probably in the nearby mountains in modern Sichuan, as has been suggested by Peiros and Shnirelman in 1998.

 

http://upload.wikimedia.org/wikipedia/commons/thumb/8/82/Sichuan_in_China_%28%2Ball_claims_hatched%29.svg/275px-Sichuan_in_China_%28%2Ball_claims_hatched%29.svg.png

H́nh 11

(Nếu ổng đoán trúng một cái th́ có lẽ trúng hết, trật một cái th́ chắc chắn trật hết; nhưng ta chưa rơ là ổng trúng hay trật.)

Ngược lại, Paul Sidwell & Roger Blench [16] cho rằng cái gốc của tiếng AA là ở khúc giữa sông Mekong, rồi từ đó lan lên phía bắc và lan xuống phía nam (h́nh 12).

dngiao/_/rsrc/1359213638427/friends/giao/origin/03/3.12.png

H́nh 12

Paul Sidwell [17] cũng cho rằng trong 9 thứ tiếng AA th́ hết 7 có lẽ từ cao nguyên Khorat kế sông Mekong hoặc là miệt gần đó (ô màu đỏ h́nh 13) mà tách ra, chừng 4000 năm trước.

In that case, perhaps 7 out of 9 Austroasiatic branches are located on or adjacent to the Khorat plateau/Mekong river. Given that rice cultivation did not arise there before 4300 BP, and Austroasiatic is rich in rice terminology, we can suggest a dramatic dispersal event around 4000 BP, broadly consistent with the suggestion of Thomas (1973).

 

http://www.dartmouth.edu/~floods/images/2003234Loc.jpg

H́nh 13

Khorat (Thái Lan) cách Huế chưa tới 540 km đường chim bay là nơi có địa điểm khảo cổ Ban Chiang di sản thếgiới, với di tích đồ đồng từ năm 2000 BC c̣n xưa hơn cả đồ đồng Đông Sơn từ năm 1425 ± 100 BC.

Bây giờ ta ghé thăm một nhà sinh học làm việc ở một viện Pasteur.

V́ sao vậy? Là v́ ta cần biết rằng trong bao tử của ít nhứt một nửa số người trên trái đất có con vi khuẩn tên Helicobacter pylori, nó đă tháp tùng những đám người di cư ra khỏi châu Phi chừng 60 ngàn năm trước và đến nay nó đă tách ra thành 7 ḍng vi khuẩn khác nhau ở những vùng khác nhau trong đó có ḍng Đông Á mà người VN đang mang. Ở đây ta không nói chuyện cái ḍng đó lợi hay hại mà là ai đă đem nó từ đâu tới VN hay là ai đă đem nó từ VN đi chỗ khác.

Sebastien Breurec et al [18] nghiên cứu gene của H. pylori ở những nhóm người sống những vùng khác nhau ở Đông nam Á và cho rằng ḍng H. pylori Đông Á đă đi theo tổtiên của đám nói tiếng Austroasiatic từ TQ xuống VN và Cambodia khi họ di cư từTQ xuống hai nơi đó chừng 4000 năm trước.

Here, we analyse housekeeping gene sequences of the human stomach bacterium Helicobacter pylori from various countries in Southeast Asia and we provide evidence that H. pylori accompanied at least three ancient human migrations into this area: i) a migration from India introducing hpEurope bacteria into Thailand, Cambodia and Malaysia; ii) a migration of the ancestors of Austro-Asiatic speaking people into Vietnam and Cambodia carrying hspEAsia bacteria; and iii) a migration of the ancestors of the Thai people from Southern China into Thailand carrying H. pylori of population hpAsia2. Moreover, the H. pylori sequences reflect iv) the migrations of Chinese to Thailand and Malaysia within the last 200 years spreading hspEasia strains, and v) migrations of Indians to Malaysia within the last 200 years distributing both hpAsia2 and hpEurope bacteria.

...Although our data are not conclusive on the source of the Austro-Asiatic expansion, the tree topology of the subcluster hspEAsia (Figure 2C) that was supported by AMOVA analyses (Table S3) is consistent with the hypothesis that ancestors of the Austro-Asiatic people migrated from southern China into Southeast Asia, introducing hspEAsia bacteria into Vietnam and Cambodia. This language family might have been spread together with rice agriculture as part of a Neolithic human diaspora from the Yangzi and Yellow River Basins in China into Southeast Asia. The settlement of Southeast Asia has been dated from about 2000 BC...

 

Xem đường màu vàng sốII trong h́nh 14.

 

dngiao/3.14.png

H́nh 14

(Đường số II chạy từ trên xuống, ư nói cái gốc của nhóm AA là ở TQ, nhưng v́ sao nó không chạy từ dưới lên trên, nghĩa là nhóm AA mang H.p. từ Đông nam Á lên TQ?)

Tóm lại, theo mấy nhà nói trên, ta vẫn chưa chắc cái gốc của đám O2a1-M95 ở đâu. Có lẽ ta phải hỏi “nhà ta”, tức là bà xă của ta, th́ mới chắc. Nhưng chuyện này là chuyện lớn, mấy bả không quyết định được; vậy ta phải tự ḿnh suy nghĩ và quyếtđịnh.

Ta biết O2a1-M95 tách ra từ O2-P31, c̣n O2-P31 th́ tách ra từ O-M175 (h́nh 9). Nhưvậy, nếu biết hai đám O2-P31* và O-M175* đang ở đâu, ta có thêm dấu vết để ḍ ra gốc gác của O2a1-M95.

Biểu 13. Phần trăm đực rựa thuộc O* và O2* trong 22 nhóm nói những thứ tiếng Hmong-Mien ởmiền nam TQ, vẽ lại theo Xiaoyun Cai et al [op. cit.].

dngiao/_/rsrc/1359381616123/friends/giao/origin/03/3.f13.png?height=400&width=324

Biểu 14. Phần trăm đực rựa thuộc O* và O2* trong 24 nhóm nói những thứ tiếng Mon-Khmer ở Đông nam Á, vẽ lại theo Xiaoyun Cai et al [op. cit.].

dngiao/_/rsrc/1359381696708/friends/giao/origin/03/3.f14.png?height=400&width=272

Biểu 15: phần trăm đực rựa thuộc O* và O2* trong 27 nhóm ở Đông Á, vẽ lại theo Yali Xue et al [op. cit.].

dngiao/_/rsrc/1359381740574/friends/giao/origin/03/3.f15.png?height=400&width=240

Biểu 16. Phần trăm đực rựa thuộc O* và O2* trong 24 nhóm ở đông bắc Ấn Độ, vẽ lại theo Gyaneshwer Chaubey et al [op. cit.].

dngiao/_/rsrc/1359381791747/friends/giao/origin/03/3.f16.png?height=400&width=337

Biểu 17: phần trăm đực rựa thuộc O* và O2* trong 7 nhóm Đông nam Á, vẽ lại theo Tatiana Karafet et al [op. cit.] và Jun-Dong He et al [op. cit.].

dngiao/_/rsrc/1359381900894/friends/giao/origin/03/3.f17.png?height=333&width=400

Biểu 18: phần trăm đực rựa thuộc O* và O2* trong 12 nhóm Đông Á, vẽ lại theo Soon-Hee Kim et al [19].

dngiao/_/rsrc/1359381946891/friends/giao/origin/03/3.f18.png?height=356&width=400

Số liệu biểu 13-18 cho thấy đại khái như sau:

  • cả O2* và O* đều có trong những nhóm ở Lào.
  • O2* khá đông trong những nhóm ở Đông nam Á nhưng thưa ở Đông bắc Á.
  • O* đông trong những nhóm nói tiếng HM ở miền nam TQ.
  • cảO2* và O* đều vắng bóng ở đông bắc Ấn Độ.

Nếu O2a1-M95 ra đời ở đông bắc Ấn Độ, th́ ngay đó hoặc gần đó bây giờ hẳn phải c̣n O2* hoặc O*, không nhiều th́ ít; đằng này không thấy O2* cũng chẳng thấy O* ở đó, như vậy có lẽ O2a1-M95 không phải ra đời ở đông bắc Ấn Độ.

Đằng khác, số liệu cho thấy cả O2* và O* bây giờ c̣n khá đông ở Lào, như vậy có lẽ O2a1-M95 đă ra đời trong đám O2 ở Lào.

C̣n đám O2* ở Đông bắc Á th́ sao? H́nh 9 cho thấy dưới O2 c̣n một nhánh khác là O2b1a-47z, mà O2b1a-47z trong sắc dân Nhật Bản chiếm gần 24% theo Soon-Hee Kim et al [op. cit.], và 22% theo Michael F. Hammer et al [20]. Đám O2b1a-47z cũng chiếm gần 9% trong sắc dân Đại Hàn, theo Soon-Hee Kim et al [op. cit.].

Nhưvậy, có lẽ O2b1a-47z đă ra đời trong đám O2 ở Đông bắc Á.

Và ta có thể phác một bức tranh như sau (h́nh 15):

  • đám O, chưa rơ từ đâu đến, có mặt ở Lào,
  • từO tách ra O2,
  • mộtđám O2 đi lên phía bắc, từ đó tách ra O2b1a-47z đi tiếp tới Nhật-Hàn.
  • mộtđám O2 ở lại, từ đó tách ra O2a1-M95.

dngiao/_/rsrc/1359466852655/friends/giao/origin/03/3.15.png?height=320&width=400

 

H́nh 15

  • từ Lào, O2a1-M95 lan lên phía trên tới nam TQ, lan xuống phía dưới tới Indonesia (h́nh 16).

dngiao/_/rsrc/1359466934358/friends/giao/origin/03/3.16.png?height=370&width=400

 

H́nh 16

Dựa theo Xiaoyun Cai et al [op. cit.], O2a1-M95 ra đời chừng 20 ngàn năm trước, th́ chuyện họ đi bộ từ Lào qua Indonesia là điều dễ hiểu, v́ từ lúc đó tới 10 ngàn năm sau, vùng biển giữa bán đảo Đông Dương với Indonesia vẫn cạn (chỗ màu xanh dương lợt ở h́nh 16) chớ chưa ngập nước như ngày nay. Cũng vậy, biển Hoàng Hải (Yellow Sea) và eo biển Đại Hàn (Korean Strait) lúc đó vẫn cạn (chỗ màu xanh dương lợt ở h́nh 15) nên đám O2b1a-47z có thể đi bộ từ TQ qua Nhật Bản và Đại Hàn.

Roger Blench [21] dựa theo tài liệu khảo cổ cũng cho rằng đám AA từ VN xuống Indonesia (h́nh 17) trước cả đám nói tiếng Austronesian, là thứ tiếng mà dân Indonesia đang nói.

dngiao/_/rsrc/1359382809711/friends/giao/origin/03/3.17.png?height=395&width=400

H́nh 17

Tóm lại, O2a1-M95* là đám đực rựa “thổ địa” ở Đông nam Á, sinh ra ở một nơi nào đó giữa Lào và Thái ngày nay, gần như hết thảy những sắc dân ở Đông nam Á ngày nay, chừng 4 gă th́ có 1 gă thuộc về O2a1-M95*, chưa kể những sắc dân ở nam TQ và đông bắc Ấn Độ.

Nói nôm na, theo số liệu đă nêu trên, chừng 10% đàn ông VN là anh em với hơn 20% đàn ông người Mường, người Chàm ở VN, người Lamet ở Lào, người Zhuang ở nam TQ, người Ho ở đông bắc Ấn Độ, thí dụ như vậy.

O2a1-M95 với tuổi đời hơn 20 ngàn năm hẳn đă ở VN sớm hơn so với nhiều đám khác; nhưng v́ sao bây giờ họ lại thưa hơn những đám khác th́ mai mốt ta sẽ có dịp t́m hiểu kỹ hơn.

O2a1-M95* bên TQ hẳn cũng góp sức lập nên những xứ xưa như Việt, Sở, và là cái “lơi” của những nhóm người xưa như Bách Bộc, Bách Việt nêu ở phần 2.

Jerry Norman [22] nêu lên nhiều thí dụ cho thấy tiếng TQ có mượn tiếng AA, và đó là chứng cớ cho thấy những đám nói tiếng AA [ta hiểu đó là những đám O2a1-M95*] đă có mặt ở nam TQ từ 2500 tới 3000 năm trước.

 

NOTES:

[1] Major East-West Division Underlies Y Chromosome Stratification Across Indonesia

[2] Patrilineal Perspective on the Austronesian Diffusion in Mainland Southeast Asia

[3] International Society of Genetic Genealogy (2012). Y-DNA Haplogroup Tree 2013, Version: 8.11, Date: 14-Jan-2013, http://www.isogg.org/tree/ 28-Jan-2013.

[4] Human Migration through Bottlenecks from Southeast Asia into East Asia during Last Glacial MaximumRevealed by Y Chromosomes

[5] Y chromosome haplotypes reveal prehistorical migrations to the Himalayas

[6] The distribution of Y chromosome haplogroups in the nationalities from Yunnan Province of China

[7]Male demography in East Asia: a north-south contrast in human population expansion times

[8] Origin of Hakka and Hakkanese: A Genetics Analysis

[9] Y-Chromosome Evidence for a Northward Migration of Modern Humans into Eastern Asia during the Last Ice Age

[10] Y-chromosome evidence suggests a common paternal heritage of Austro-Asiatic populations

[11] Population Genetic Structure in Indian Austroasiatic Speakers: The Role of Landscape Barriers and Sex-Specific Admixture

[12] The Peopling of Korea Revealed by Analyses of Mitochondrial DNA and Y-Chromosomal Markers

[13]Proto-East Asian and the Origin and Dispersal of the Languages of East and Southeast Asia and the Pacific

[14] Rice and the Austroasiatic and Hmong-Mien homelands

[15] Some thoughts on the problem of the Austro-Asiatic homeland

[16] The Austroasiatic Urheimat: the Southeastern Riverine Hypothesis

[17] Family Diversity and the Austroasiatic Homeland

[18] Evolutionary History of Helicobacter pylori Sequences Reflect Past Human Migrations in Southeast Asia

[19] High frequencies of Y-chromosome haplogroup O2b-SRY465 lineages in Korea: a genetic perspective on the peopling of Korea

[20]Dual origins of the Japanese: common ground for hunter-gatherer and farmer Y chromosomes

[21] Was there an Austroasiatic presence in island Southeast Asia prior to the Austronesian expansion?

[22] The Austroasiatics in Ancient South China: Some Lexical Evidence

 

28-Jan-2013

Đ. N. Giao